Files from The Internet May Contain Viruses

This is what Excel told me when I downloaded a list of British and South African variant Oligomers:

TGTAAAACGACGGCCAGTAACAACTTCTGTGGCCCTGATG
TGTAAAACGACGGCCAGTACTTACACCACTGGGCATTGATT
TGTAAAACGACGGCCAGTACTTCTATTAAATGGGCAGATAACAACTGT
TGTAAAACGACGGCCAGTTGTTATGATGTCAGCACCACCTG
TGTAAAACGACGGCCAGTAAACCGTGTTTGTACTAATTATATGCCTT
TGTAAAACGACGGCCAGTAGTCCAGAGTACTCAATGGTCTTTGT
TGTAAAACGACGGCCAGTACTTCAGAGAGCTAGGTGTTGTACA
TGTAAAACGACGGCCAGTACGATGGTGGCTGTATTAATGCT
TGTAAAACGACGGCCAGTGGAGTATGCTGATGTCTTTCATTTGTAC
CAGGAAACAGCTATGACCTCTGAATTGTGACATGCTGGACA
CAGGAAACAGCTATGACCCTGCAACACCTCCTCCATGTTT
CAGGAAACAGCTATGACCAGCACCGTCTATGCAATACAAAGT
CAGGAAACAGCTATGACCAGCCACCACATCACCATTTAAGT
CAGGAAACAGCTATGACCTGCCAAAAACCACTCTGCAACT
CAGGAAACAGCTATGACCACAATACCTCTGGCCAAAAACATGA
CAGGAAACAGCTATGACCTGCGAAAAGTGCATCTTGATCCT
CAGGAAACAGCTATGACCGGTGTGACAAGCTACAACACGT
CAGGAAACAGCTATGACCGCGTTTCTGCTGCAAAAAGCTT
CAGGAAACAGCTATGACCAAGTAGGGACTGGGTCTTCGAA

People are trying their best to keep pace with developments, as I suspected.

I was looking in to how the instrument manufacturers are gearing up.

“Ion Torrent targeted next-generation sequencing (NGS) technology enables a streamlined research workflow for complete viral genome sequencing and variant detection for epidemiological studies of SARS-CoV-2.

The Ion AmpliSeq SARS-CoV-2 Research Panel consists of two pools with amplicons ranging from 125 bp to 275 bp in length and covers >99% of the SARS-CoV-2 genome, including all serotypes. The assay is part of a fast, automated, and accurate targeted NGS workflow that enables coronavirus typing in under a day. This end-to-end solution includes the assay and plug-in suite that was developed in collaboration with researchers at the forefront of the SARS-CoV-2 crisis. Our complementary targeted NGS systems makes SARS-COV-2 epidemiology research accessible to any lab, regardless of your team’s current level of NGS expertise.”

And exploring the new variant in India, which if I understand it correctly, has 771 variants in total, as of today. Unsurprisingly given the links with the UK, the “Kent” variant is common.

The work up for a PCR test is substantive and there must loads of people nose to the grindstone doing shed loads of these. We haven’t heard anyone thank them yet. I guess the instrument manufacturers are selling loads of kit and they too must be working flat out to meet demand.

In France we are due another briefing this evening and the situation looks like this. There was a 20% increase in westward traffic on SNCF the night before the confinement in Paris. So, I guess the viral per capita density is likely to go up in our ‘hood. We are second from the left on the top.

And in the UK the press is saying how clever they are and how the EU is “humiliated”. What planet are they on? People are moaning about summer holidays and discussing whether people will need a vaccination certificate to go down the pub.

I myself am getting increasingly concerned about the civil liberties implications of having a vaccine certificate. A get out of gaol free card. If you are unwilling to be vaccinated, then you can’t do certain things. It is a bit like coercing. If you have ethical problems with the way vaccines are developed, tough. If you have high allergic responses, then no pint of Guinness down the pub for you. People have got to be more careful when extroverting their latest “great” idea. It can be dangerous if it is not thought through.

When I was a kid, we had to have an X-ray to prove we did not have tuberculosis before we were allowed into Australia. I was accustomed to having a vaccination card, for cholera, smallpox, yellow fever, tetanus and typhoid. More recently hepatitis A and B. A certificate for travel makes sense, but needing one to go to the shops?

Things like this pandemic allow people’s true nature to surface. It will be interesting to see how this civil liberties issue proceeds.  I am getting slightly concerned about where this is going…

Hmnn.