The Dangers of Hype and Bragging

When uncle Boris started talking about an irrevocable exit from pandemic, I thought to myself “that is a pretty stupid thing to say. Talk about setting potentially unrealistic expectations.”

Now people are talking about Freedom Day. Oh dear.

Unless you have worked extensively with non-linear equations it is really easy to misunderstand. Most people have linear only thinking.

Back when things started to kick off in the USA, I started doing a naïve, no assumption modelling of the incoming data. A simple exponential fit predicted very well the initial and fast ramp up in case numbers.

I have had a little play with the most recent UK case numbers.

This ultra-naïve model which does not as yet fit very well predicts over 7000 cases a day in a couple of weeks, rising reasonably quickly to over ten thousand.

The so-called irrevocability is very much in the balance…

Rainy Saturday and SARS-CoV Binding.

It is raining on and off here this afternoon, so I have been delving a little into the SARS literature. Below is a model highlighting {I think} where the spike glycoprotein is changed in the various variants. The ACE2 is the human lung receptor{brown spirally thing}, the three variants on the top right-hand side change close to where the virus protein binds to the human lung at the receptor binding domain {RBD}.

Below is the near molecular detail of how SARS-CoV and SARS-CoV-2 bind to the receptor {the green spirally thing}. The mechanism between the two viruses looks quite different with what looks like hydrogen bonding in the more recent virus.

How strong these bonds are along with the ease of conformational change will affect the virus binding {and release} rate constants. It must bind to replicate and must release at some stage in order to spread via coughing etc..

I wondered has anybody tried making a compound that preferentially binds to the ACE2 site in competition to the virus. Seems like a strategy for treating the disease. Add a high concentration of the ACE2 site blocker and outcompete the virus. If only a few hydrogen bonds enable the virus to bind it might be possible to design an antagonist molecule that is not toxic.

Hmnn…

Independent Panel Review of Covid-19 Response

It has been raining here today so no gardening. I thought I would read the independent panel review to cheer myself up. Here are some excerpts:

Zoonotic Pathogen – we shall probably have a few more of these in due course.

Pandemic simulations might be a tad disconcerting.

Public Health Emergency of International Concern – Let’s Wait and See – The Lost Month

Dodgy Leaders With Ego Problems – Made It Worse

Someone made a buck or two.

Need for a United Nations General Assembly on Pandemic Preparedness

Need for a complete change in paradigm – a serious shift in mind-sets.

In an ideal world – yes.

The world is interconnected but are people ready for a change on that scale?

Do people want to be equitable?

Pharma and Pandemic

Covid : Moderna devrait gagner 19 milliards de dollars avec son vaccin cette année

La biotech américaine table désormais sur des revenus de 19,2 milliards de dollars contre 18,4 milliards annoncés précédemment grâce à son vaccin ARN.

———————–

Pfizer forecasts $26bn from annual sales of Covid-19 vaccine

Vaccine will generate 73% more than forecast based on contracts signed until mid-April

The US drugmaker Pfizer has smashed its sales forecasts and now expects to bring in $26bn (£19bn) of revenue from its Covid-19 vaccine this year, with its soaraway product accounting for more than a third of the company’s annual income.

The company had expected the vaccine to bring in $15bn over the course of 2021, and the 73% increase in expected revenues to $26bn is still likely to be an underestimate as it counts only orders received by the middle of April and Pfizer is expected to sign more multibillion dollar supply contracts.

————————-

EN DIRECT – Covid : pour BioNTech, suspendre les brevets n’aura pas d’incidence sur la production mondiale

Le laboratoire allemand estime que la protection intellectuelle n’est pas un facteur limitant la production et l’approvisionnement de son vaccin développé avec l’américain Pfizer. Dans le sillage des Etats-Unis, l’Europe et la Russie ont ouvert la porte à une suspension des brevets.

———————

‘Ill-judged’ bonus hike for AstraZeneca boss prompts investor anger

Advisory groups ask shareholders to oppose bid to raise Pascal Soriot’s maximum share bonus to 650% of £1.3m basic pay.

AstraZeneca is facing mounting opposition over its plans to award its chief executive, Pascal Soriot, a big increase in bonuses, with three investor advisory groups calling on shareholders to vote against the policy.

Pirc, Glass Lewis and Institutional Shareholder Services (ISS) have all flagged concerns over moves to raise the maximum share bonus Soriot can receive under a long-term plan from 550% of his £1.3m base salary to 650%. AZ also plans to hoist Soriot’s maximum annual bonus to 250% of salary from 200%, depending on performance targets being hit.

————–

EU ‘ready to discuss’ COVID vaccine patent waiver as drugmakers push back.

The European Union is willing to discuss a proposal to waive intellectual property rights for COVID-19 vaccines, European Commission President Ursula von der Leyen said on Thursday, as drugmakers fought their ground as their share prices tumbled.

U.S. President Joe Biden on Wednesday voiced support for a waiver in a sharp reversal of the U.S. position, and his top trade negotiator, Katherine Tai, swiftly backed negotiations at the World Trade Organization.

———-

Drugmakers say Biden misguided over vaccine patent waiver

Drugmakers on Thursday said U.S. President Joe Biden’s support for waiving patents of COVID-19 vaccines could disrupt a fragile supply chain and that rich countries should instead share more generously with the developing world.

Biden on Wednesday threw his support behind waiving intellectual property rights for COVID-19 vaccines, angering research-based pharmaceutical companies.

———–

Gilead raises 2020 profit forecast on remdesivir strength

Gilead Sciences raised its full-year profit forecast on Monday, as a recent resurgence in Covid-19 cases boosted demand for its Covid-19 treatment, remdesivir.

The level of new Covid-19 cases in the U.S. is starting to rise again, amidst the slow rollout of vaccine. Experts say the country should expect another surge in mid-January due to holiday gatherings.

The antiviral, currently authorized to treat Covid-19 patients across the world, was one of the drugs used to treat U.S. President Donald Trump’s coronavirus infection.

Gilead said it was raising its total product sales forecast to the range of $24.30 billion to $24.35 billion, reflecting increased sales of remdesivir.

Is Covid a Metaphor for Deforestation?

This is prompted by an article in Les Echos.

« Les poumons de la planète sont au bord de l’asphyxie

Qu’ils soient verts ou bleus, les puits de carbone et de régulation climatique se dégradent inexorablement. Leur mécanisme pourrait même se retourner contre l’équilibre atmosphérique global. »

This is a pair of years in which we heard the phrase “I can’t breathe” and when there is a shortage of oxygen, dephlogisticated air, where people have died struggling to breathe in their hundreds of thousands. A year in which the lungs of the planet, Brazil, have continued to be scorched and where the death toll of not breathing is very high. The leadership has done little to prevent deforestation and pooh-poohed the virus. It is a time of floods and fire. When the air has been filled with smoke.

As we stop the planet from breathing, is it stopping us from breathing too? Have a taste of your own medicine you nasty, greedy human beings. See what I feel like when I can’t breathe.

Is it our knee on the neck of the planet?

On the way back from the supermarket I suggested to the wife that we buy a dephlogisticator just in case. As the oxygen content in the atmosphere drops, we might be in dire need.

I don’t think we are paying sufficient attention to what the planet, the universe, is trying to teach us!

It seems people can only see the light at the end of the tunnel, so that they can get back to “normal”. Have drink in a bar and go on holiday. What we don’t perhaps realise is that the light is a TGV {Train à Grande Vitesse} heading in our general direction.

Vaccination Queue Dream 28-04-21

This dream was far less technicolour than the previous one.

I am in a small village in rural Buckinghamshire, one that I do not know well. I am on my way back from the vaccination centre because I have been turned away because I did not have any proof of identity on me. I am going back home to get some proof. I encounter a man I haven’t met. He is looking intensely at me as if he recognises me. He explains this, that he is sure that he knows me from somewhere. I tell him that I am relatively new to the village having just moved there. I say that I used to be a lecturer in Chemistry in London. He suggests that we go for a pint in the local pub which we do. I then tell him that I have to leave. We walk past his cottage and he invites me in. He shows me a cushion with some words in Welsh embroidered on it. I ask him if he is Welsh too. No, he is Australian. He suggests that we go for another pint later in the week.

I arrive home but cannot find my passport. I can find my Titre de Séjour card and resolve that this will do. I make my way back to the vaccine centre. People are queued up without masks. I go back outside and put my mask on. I then re-join the queue. It is very busy and the woman on reception is taking names and checking ID. I am ushered to a holding area. In the holding area are various people from my past, T, J, N, A etc. I am surprised to see them. I did not know that they had moved to the country. The notion is that they moved out of the city to get away from the pandemic. One of them had problems with his husband. They are all looking older than when I knew them.

A nurse comes over and says that I need to go to see the Doctor to check if It is OK for me to have the vaccine. Initially I am to be given the BioNTech one, not AZ like the others. She will escort me across town for the medical. When we get outside it starts to rain. I pull on my old brown jumper and say that I will enjoy the fresh rain on my face. We get to the surgery across town. At first, I am the only one there. Then it starts to fill up until it too is near swamped. The staff there are unsure what to do. They decide to prioritise the appointments according to risk level. I say that I have 3 or 4 points on the Charlson Comorbidity Index, that I am technically obese and that I have an allergy. The woman ushers me to one side and begins checking the others.

Dream ends.

The Karma of Smugness and Gloating

Do you think that being smug and gloating are good things to do?

I have been getting slightly concerned about how the vaccine rich are boasting about how well they are doing.

“Look at us aren’t we great everybody else is pants.”

“Those pesky Europeans have f£$%ed it up!”

“My aren’t we clever.”

This is very separative. It is in many ways throwing down the gauntlet to the universe to offer a karmic response.

What we don’t often see in national news is the global charts. This one is from Reuters.

If there are >600,000 new infections per day that is plenty to sample the phase space of viral mutation. Some mutations must be more probable than others. Sampling > 3 million infections per week will find new mutations of unknown transmissibility and which may not be prone to the antibodies produced by the current vaccines.

The world is interconnected probably best not to stick one’s head up one’s own arse.

It could get very groundhog.

Hmnn.

Avant du Confinement

I have to admit that I am getting more than a little bored with all the Covid coverage in the media. And all this shit about who is doing a better vaccine roll out than who seems markedly petty. {Look my cock is bigger than yours.} Countries are comparing who has the highest per capita viral infestation and placing each other into no travel zones. There is a hell of a lot of “comparison mind” at work, minor differences of well under an order of magnitude are touted as highly significant. I think like others I may have Covid fatigue even Covid apathy. And now uncle Boris has his virus passport stroke of divisive genius. Each New Thought Propels, I know let’s build a bridge between Ireland and Scotland, when the coffers at the Treasury are already empty…

Get vaccinated or no pub for you pleb!

I almost cannot be bothered to get vaccinated, what would it enable me to do that I might want to do? Even if I was vaccinated, I would not change my lifestyle all that much. I am allowed to have one now and have been prompted by the computer system.

Anyway we are soon going to be confined in a particle on a ring like manner to a radius of 10 km which means no seaside trips for a month, so this morning we have been up to the sentier des douaniers on the coast. This is where the customs officers surveyed the shipment of cognac to Cornwall and rum to France. It was brisk and invigorating.

On the way there I played spot the out of canton cars. In France all number plates have a number relating to the department.  In the car park by the sea there were three cars from Provence-Alpes-Côte d’Azur, the bottom right-hand corner of France. Part of this has already been in lockdown and the per capita virus infestation is a lot higher than here in 22. So, people are fleeing the plague and perhaps bringing it with them. There were loads of Parisian plates too. After this weekend travel outside the 10 km radius is forbidden. As a general rule of thumb, the more expensive the car is the more likely it is from outside our region. About one third of the cars this morning was belonging to “out of towners”.

Maybe they want to experience the Breton coronavirus variant as well at the Kent one which is heading south from the Pas de Calais? Quite a few more of the shuttered properties, the second homes were open this morning.

So here we go again….

Files from The Internet May Contain Viruses

This is what Excel told me when I downloaded a list of British and South African variant Oligomers:

TGTAAAACGACGGCCAGTAACAACTTCTGTGGCCCTGATG
TGTAAAACGACGGCCAGTACTTACACCACTGGGCATTGATT
TGTAAAACGACGGCCAGTACTTCTATTAAATGGGCAGATAACAACTGT
TGTAAAACGACGGCCAGTTGTTATGATGTCAGCACCACCTG
TGTAAAACGACGGCCAGTAAACCGTGTTTGTACTAATTATATGCCTT
TGTAAAACGACGGCCAGTAGTCCAGAGTACTCAATGGTCTTTGT
TGTAAAACGACGGCCAGTACTTCAGAGAGCTAGGTGTTGTACA
TGTAAAACGACGGCCAGTACGATGGTGGCTGTATTAATGCT
TGTAAAACGACGGCCAGTGGAGTATGCTGATGTCTTTCATTTGTAC
CAGGAAACAGCTATGACCTCTGAATTGTGACATGCTGGACA
CAGGAAACAGCTATGACCCTGCAACACCTCCTCCATGTTT
CAGGAAACAGCTATGACCAGCACCGTCTATGCAATACAAAGT
CAGGAAACAGCTATGACCAGCCACCACATCACCATTTAAGT
CAGGAAACAGCTATGACCTGCCAAAAACCACTCTGCAACT
CAGGAAACAGCTATGACCACAATACCTCTGGCCAAAAACATGA
CAGGAAACAGCTATGACCTGCGAAAAGTGCATCTTGATCCT
CAGGAAACAGCTATGACCGGTGTGACAAGCTACAACACGT
CAGGAAACAGCTATGACCGCGTTTCTGCTGCAAAAAGCTT
CAGGAAACAGCTATGACCAAGTAGGGACTGGGTCTTCGAA

People are trying their best to keep pace with developments, as I suspected.

I was looking in to how the instrument manufacturers are gearing up.

“Ion Torrent targeted next-generation sequencing (NGS) technology enables a streamlined research workflow for complete viral genome sequencing and variant detection for epidemiological studies of SARS-CoV-2.

The Ion AmpliSeq SARS-CoV-2 Research Panel consists of two pools with amplicons ranging from 125 bp to 275 bp in length and covers >99% of the SARS-CoV-2 genome, including all serotypes. The assay is part of a fast, automated, and accurate targeted NGS workflow that enables coronavirus typing in under a day. This end-to-end solution includes the assay and plug-in suite that was developed in collaboration with researchers at the forefront of the SARS-CoV-2 crisis. Our complementary targeted NGS systems makes SARS-COV-2 epidemiology research accessible to any lab, regardless of your team’s current level of NGS expertise.”

And exploring the new variant in India, which if I understand it correctly, has 771 variants in total, as of today. Unsurprisingly given the links with the UK, the “Kent” variant is common.

The work up for a PCR test is substantive and there must loads of people nose to the grindstone doing shed loads of these. We haven’t heard anyone thank them yet. I guess the instrument manufacturers are selling loads of kit and they too must be working flat out to meet demand.

In France we are due another briefing this evening and the situation looks like this. There was a 20% increase in westward traffic on SNCF the night before the confinement in Paris. So, I guess the viral per capita density is likely to go up in our ‘hood. We are second from the left on the top.

And in the UK the press is saying how clever they are and how the EU is “humiliated”. What planet are they on? People are moaning about summer holidays and discussing whether people will need a vaccination certificate to go down the pub.

I myself am getting increasingly concerned about the civil liberties implications of having a vaccine certificate. A get out of gaol free card. If you are unwilling to be vaccinated, then you can’t do certain things. It is a bit like coercing. If you have ethical problems with the way vaccines are developed, tough. If you have high allergic responses, then no pint of Guinness down the pub for you. People have got to be more careful when extroverting their latest “great” idea. It can be dangerous if it is not thought through.

When I was a kid, we had to have an X-ray to prove we did not have tuberculosis before we were allowed into Australia. I was accustomed to having a vaccination card, for cholera, smallpox, yellow fever, tetanus and typhoid. More recently hepatitis A and B. A certificate for travel makes sense, but needing one to go to the shops?

Things like this pandemic allow people’s true nature to surface. It will be interesting to see how this civil liberties issue proceeds.  I am getting slightly concerned about where this is going…

Hmnn.